Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_400071 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 28184940 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 8 Gastric Cancer (GC) tissues and adjacent tissue samples |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CCCAAGGGTTTGGTGGGAT ReverseAGAGCCCAGAGTGGGAGAAGTC | Statistics | Fold Change : Upregulated,3.77 pvalue : p=0.007 |
Citation | |||
Sui, W, Shi, Z, Xue, W, Ou, M, Zhu, Y, Chen, J, Lin, H, Liu, F, Dai, Y (2017). Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology. Oncol. Rep., 37, 3:1804-1814. |