circad | circRNAs associated with diseases

hsa_circRNA_400071
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28184940
Experimental Method
Sample Type	Tissues	Comparison	8 Gastric Cancer (GC) tissues and adjacent tissue samples
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCCAAGGGTTTGGTGGGAT Reverse AGAGCCCAGAGTGGGAGAAGTC	Statistics	Fold Change : Upregulated,3.77 pvalue : p=0.007
Citation
Sui, W, Shi, Z, Xue, W, Ou, M, Zhu, Y, Chen, J, Lin, H, Liu, F, Dai, Y (2017). Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology. Oncol. Rep., 37, 3:1804-1814.